| Basics of Genetics
GlaxoSmithKline's genetic research efforts will
help change the way medicines are discovered, developed, and
prescribed and the way many diseases are diagnosed and treated.
GSK is an industry leader in the field of ,
focusing on the examination of the genetic basis of common
diseases and patients' responses to medicines — learning
about the identity and function of genes associated with diseases
and understanding why some medicines work better for certain
people than others and who is most likely to experience a
serious side effect.
For more information about general
Research and Development efforts at GlaxoSmithKline, see http://science.gsk.com.
To better understand genetic research, it's
helpful to explore some basic genetic terms.
DNA
How do cells know what to do in your body? How
can DNA determine what you will look like?
Instructions that provide almost all of the
information necessary for a living organism to grow and function
are in the nucleus of every cell. These instructions tell
the cell what role it will play in your body. The instructions
are in the form of a molecule called deoxyribonucleic acid,
or .
DNA is the chemical responsible for preserving,
copying and transmitting information within cells and from
generation to generation.
In humans, the DNA molecule consists of two
ribbon-like strands that wrap around each other, resembling
a twisted ladder. This is often described as a double helix.
DNA is contained in tightly coiled packets called ,
found in the nucleus of every cell. Chromosomes consist of
the double helix of DNA wrapped around proteins.
The twisted ladder is made up of repeating units
called ,
each of which is a single building block of DNA. Nucleotides
are composed of one sugar-phosphate molecule (the linear strands
or outer rails of the ladder) and one base. DNA consists of
two nucleotide strands joined by weak chemical bonds between
the two bases, forming base pairs. A base pair is a rung or
step on the ladder of the DNA. The bases are called A (for
adenine), C (for cytosine), T (for thymine) and G for guanine.
These bases always pair up in the following
way:
· A+T
· C+G
A single strand of DNA is made of letters:
ATGCTCGAATAAATGTGAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences:
<ATG CTC GAA TAA> <ATG TGA ATT TGA>
These "sentences" are called genes.
Genes tell the cell to make other molecules called proteins.
are required for the structure, function, and regulation of
the body's cells, tissues, and organs.
We have approximately three billion base pairs
(6 billion bases total) of DNA in most of our cells. This
complete set of genes is called a .
With the exception of identical twins, the sequence of the
bases is different for everyone, which makes each of us unique.
DNA and Human Diversity
Although we all look quite different from one
another, we are surprisingly alike at the DNA level. The DNA
of most people is 99.9 percent the same.
Only about 3 million base pairs are responsible
for the differences among us — which is only one tenth
of 1% of our DNA. Yet these DNA base sequence variations influence
most of our physical differences and many of our other characteristics,
as well.
Sequence variations occur in our genes,
and the resulting different forms of the same gene are called
.
People can have two identical or two different alleles for
a particular gene.
Mutations
A
or
is a change in the DNA "letters" of a gene or an
alteration in the chromosomes.
Polymorphisms are common differences in the
sequence of DNA, occurring in at least 1% of the population.
Mutations are less common differences, occurring in less than
1% of the population.
What is a mutation in one place may be a polymorphism
in another. For example, the base change that causes sickle
cell anemia is defined as a mutation in Caucasian populations
because it occurs in less than 1% of people. In parts of Africa
where it is found in 25% of the population, it is defined
as a polymorphism.
Most DNA variation is neutral (not beneficial
or harmful), but harmful sequence changes sometimes do occur.
Changes within genes can result in proteins that don't work
normally or don't work at all. Some of these changes can contribute
to disease or affect how someone responds to a medicine.
Mutations may be passed down from parent to
child (in the sperm or egg cells), may occur around the time
of conception or may be acquired during a person's lifetime.
Mutations can arise spontaneously during normal
cell functions, such as when a cell divides, or in response
to environmental factors such as toxins, radiation, hormones,
and even diet.
Nature provides us with a system of finely
tuned repair
that find and fix most DNA errors. But as our bodies change
in response to age, illness and other factors, our repair
systems may become less efficient. Uncorrected mutations can
accumulate, resulting in diseases such as cancer.
Genes
Genes are the basic units of heredity
in living cells. They consist of a length of DNA that contains
instructions ("codes") for making a specific protein.
Through these proteins, our genes influence
almost everything about us, including how tall we will be,
how we process foods, and how we respond to infections and
medicines.
Although most of our cells have the same genes,
not all genes are active in every cell. Heart cells synthesize
proteins required for that organ's structure and function;
liver cells make liver proteins, and so on. In other words,
not all the genes are "switched on" and expressed
as proteins within every cell. Within an individual cell,
the same genes may be switched on at some times and switched
off at other times.
|
